circad | circRNAs associated with diseases

hsa_circ_0023404/circRNA_100876/circ-CER
Gene	RNF121	Organism	Human
Genome Locus	chr11:71668272-71671937:+	Build	hg19
Disease	Non small cell Lung Cancer	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink	Link to database	PMID	28343871
Experimental Method
Sample Type	Tissues	Comparison	101 paired NSCLC and adjacent non-tumor tissue specimens
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CTGGTGCAGTGGAAGCAGAG Reverse CGACCCTCCATTGCTCTTCT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Yao, JT, Zhao, SH, Liu, QP, Lv, MQ, Zhou, DX, Liao, ZJ, Nan, KJ (2017). Over-expression of CircRNA_100876 in non-small cell lung cancer and its prognostic value. Pathol. Res. Pract., 213, 5:453-456.